circad | circRNAs associated with diseases

hsa_circ_0000479
Gene	EPSTI1	Organism	Human
Genome Locus	chr13:43528083-43544806:-	Build	hg19
Disease	Systemic Lupus Erythematosus	ICD-10	Drug-induced systemic lupus erythematosus (M32)
DBLink	Link to database	PMID	31608065
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	10 SLE patients, stratified by their disease activity characteristics, and 10 HCs.
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAGAGAAGAATCTGTAAGAATCA Reverse TGGTGCTATCAAGGTGTA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Guo, G, Wang, H, Ye, L, Shi, X, Yan, K, Lin, K, Huang, Q, Li, B, Lin, Q, Zhu, L, Xue, X, Zhang, H (2019). Hsa_circ_0000479 as a Novel Diagnostic Biomarker of Systemic Lupus Erythematosus. Front Immunol, 10:2281.